The WeakReference class, monitoring memory leak and garbage collection in a Java application

-
Image
 Below is a Stack implementation that uses an internal resizeable array structure.  public class MyStack< T > implements Stack< T > { private static final int CAPACITY = 100 ; private Object[] array ; private int pos = 0 ; public MyStack () { this . array = new Object[ CAPACITY ] ; } @Override public void push ( T item) { if ( pos >= array . length / 2 ) { Object[] newArray = new Object[ pos * 2 ] ; System. arraycopy ( array , 0 , newArray , 0 , array . length ) ; array = newArray ; } array [ pos ++] = item ; } @Override public T pop () { if (isEmpty()) { throw new RuntimeException( "empty stack" ) ; } @SuppressWarnings ( "unchecked" ) T item = ( T ) array [ pos - 1 ] ; pos -= 1 ; return item ; } @Override @SuppressWarnings ( "unchecked" ) public T peek...
Post a Comment

Java Bit Manipulation For Repeated DNA Sequences

-

Problem description from LeetCode:

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

 Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

 Example:
Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC", "CCCCCAAAAA"]

Solution:
The idea is that we can use 2 bits to store a letter. 
We use a map to count occurences of 10 letter sequences.
When we get a new letter, we shift 2 bits to the left and then append the new letter.
After appending 11th character, we must remove the first char on the left.
To remove it, since we store 10 letters in 20 bits, our bit mask is: 0xFFFFF

Source Code:

public class RepeatedDNA {

    public static List findRepeatedDnaSequences(String string) {

        if (string.isEmpty()) {
            return new ArrayList<>();
        }

        if (string.length() <= 10) {
            return new ArrayList<>();
        }

        List result = new ArrayList<>();

        char[] s = string.toCharArray();

        Map map = new HashMap<>();

        int code = 0;
        for (int i = 0; i < 10; ++i) {
            code = (code << 2) | mapping(s[i]);
            //    System.out.println(code);
        }

        map.put(code, 1);

        for (int i = 10; i < s.length; ++i) {

            code = ((code << 2) & (0xFFFFF)) | mapping(s[i]);

            // System.out.println(Integer.toBinaryString(code));

            Integer count = map.get(code);

            if (count == null) {
                map.put(code, 0);
                count = 0;
            }

            if (count == 1) {
                result.add(string.substring(i - 9, i + 1));
            }

            map.put(code, count + 1);
        }
        
        return result;
    }

    static int mapping(char s) {
        if (s == 'A') return 0;
        if (s == 'C') return 1;
        if (s == 'G') return 2;
        if (s == 'T') return 3;

        return -1;
    }

    public static void main(String[] args) {

        List result = findRepeatedDnaSequences(
                "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
        );

        for (String item : result) {
            System.out.println(item);
        }
    }
}

Comments

Post a Comment

Popular posts from this blog

Trie Data Structure and Finding Patterns in a Collection of Words

-
Image
 I faced a very hard problem recently about finding substrings based on a collection of patterns.  Example For  words = ["Apple", "Melon", "Orange", "Watermelon"]  and  parts = ["a", "mel", "lon", "el", "An"] , the output should be  findSubstrings(words, parts) = ["Apple", "Me[lon]", "Or[a]nge", "Water[mel]on"] . While  "Watermelon"  contains three substrings from the  parts  array,  "a" ,  "mel" , and  "lon" ,  "mel"  is the longest substring that appears first in the string. Note: Number of words and number of parts can be huge! A brute force method or careless usage of Java String methods would make it impossible to handle a large number of words and parts (patterns). Solution Approach Whenever we want to search patterns inside a string, we should think about the Trie data structure:  https://en.wikipedia....
Read more

My Crappy Looking Solution to "Binary Tree Common Ancestor" Problem

-
I was able to solve this problem and make all the tests pass: https://www.hackerrank.com/challenges/binary-search-tree-lowest-common-ancestor/problem But I'm not happy with the code, so later I need to refactor the code. Here it is: static Node lca(Node root, int v1, int v2) { ArrayList result = new ArrayList<>(); Node result2 = traverse (root, v1, v2, result); if (result.isEmpty()) return result2; return result.get( 0 ); } private static Node traverse(Node root, int v1, int v2, ArrayList result) { if (!result.isEmpty()) { return result.get( 0 ); } if (root. left == null && root. right == null ) { return root; } if (root. data == v1 || root. data == v2) { return root; } Node node1 = null , node2 = null ; if (root. left != null ) node1 = traverse (root. left , v1, v2, result); if (root. right != null ) node2 = traverse (root. right , v1, v...
Read more

A Graph Application in Java: Using WordNet to Find Outcast Words

-
Image
I'll explain our intent with an example: Let's say we have the following words: horse, zebra, cat, bear, table Which one is the outcast? The table.. But how can a computer system find this? We are talking about the whole English language and any word can be in this list. The number of words in the list can be huge, so the solution should use appropriate data structures and algorithms.  We'll use WordNet which is a graph of English words. It contains the semantic relationships between words and our concern is the "is a" relationship. For our example, we know that horse and cat are both animals. "Table" is not an animal and it is the outcast in this situation. But we even have the ability to tell that horse and zebra is very close. Below is a unit test that shows a high level view of our application in Java: public class OutcastTest {     private WordNet wordNet;     private Outcast outcast;     @Before ...
Read more