Kotlin Language Features Related to Null Handling

Any software engineer with a Java background would find the null handling features in the Kotlin language interesting. Let's summarize this topic with some examples. Nullable types: In Kotlin, types are non-nullable by default. If you want a variable to be able to hold a null value, you need to explicitly declare its type as nullable using the Type? syntax. For example, String? denotes a nullable string, while String represents a non-nullable string. Safe calls (?.): Kotlin introduces the safe call operator (?.) for handling nullable types. It allows you to safely invoke a method or access a property on a nullable object. If the object is null, the expression returns null instead of throwing a NullPointerException. Example: data class Person(val name: String, val age: Int, val address: String?) fun main() {     // Create a person with a nullable address     val person1 = Person("John Doe", 25, "123 Main Street")     val person2 = Person("Jane Doe", 30,...

Java Bit Manipulation For Repeated DNA Sequences


Problem description from LeetCode:

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

Example:
Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC", "CCCCCAAAAA"]

Solution:
The idea is that we can use 2 bits to store a letter. 
We use a map to count occurences of 10 letter sequences.
When we get a new letter, we shift 2 bits to the left and then append the new letter.
After appending 11th character, we must remove the first char on the left.
To remove it, since we store 10 letters in 20 bits, our bit mask is: 0xFFFFF

Source Code:

public class RepeatedDNA {

    public static List findRepeatedDnaSequences(String string) {

        if (string.isEmpty()) {
            return new ArrayList<>();
        }

        if (string.length() <= 10) {
            return new ArrayList<>();
        }

        List result = new ArrayList<>();

        char[] s = string.toCharArray();

        Map map = new HashMap<>();

        int code = 0;
        for (int i = 0; i < 10; ++i) {
            code = (code << 2) | mapping(s[i]);
            //    System.out.println(code);
        }

        map.put(code, 1);

        for (int i = 10; i < s.length; ++i) {

            code = ((code << 2) & (0xFFFFF)) | mapping(s[i]);

            // System.out.println(Integer.toBinaryString(code));

            Integer count = map.get(code);

            if (count == null) {
                map.put(code, 0);
                count = 0;
            }

            if (count == 1) {
                result.add(string.substring(i - 9, i + 1));
            }

            map.put(code, count + 1);
        }
        
        return result;
    }

    static int mapping(char s) {
        if (s == 'A') return 0;
        if (s == 'C') return 1;
        if (s == 'G') return 2;
        if (s == 'T') return 3;

        return -1;
    }

    public static void main(String[] args) {

        List result = findRepeatedDnaSequences(
                "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
        );

        for (String item : result) {
            System.out.println(item);
        }
    }
}

Comments

Popular posts from this blog

Trie Data Structure and Finding Patterns in a Collection of Words

A Graph Application in Java: Using WordNet to Find Outcast Words

swapLexOrder: Finding lexicographically largest string