Kotlin Language Features Related to Null Handling

-
Any software engineer with a Java background would find the null handling features in the Kotlin language interesting. Let's summarize this topic with some examples. Nullable types: In Kotlin, types are non-nullable by default. If you want a variable to be able to hold a null value, you need to explicitly declare its type as nullable using the Type? syntax. For example, String? denotes a nullable string, while String represents a non-nullable string. Safe calls (?.): Kotlin introduces the safe call operator (?.) for handling nullable types. It allows you to safely invoke a method or access a property on a nullable object. If the object is null, the expression returns null instead of throwing a NullPointerException. Example: data class Person(val name: String, val age: Int, val address: String?) fun main() {     // Create a person with a nullable address     val person1 = Person("John Doe", 25, "123 Main Street")     val person2 = Person("Jane Doe", 30,...
Post a Comment

Java Bit Manipulation For Repeated DNA Sequences

-

Problem description from LeetCode:

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

 Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

 Example:
Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC", "CCCCCAAAAA"]

Solution:
The idea is that we can use 2 bits to store a letter. 
We use a map to count occurences of 10 letter sequences.
When we get a new letter, we shift 2 bits to the left and then append the new letter.
After appending 11th character, we must remove the first char on the left.
To remove it, since we store 10 letters in 20 bits, our bit mask is: 0xFFFFF

Source Code:

public class RepeatedDNA {

    public static List findRepeatedDnaSequences(String string) {

        if (string.isEmpty()) {
            return new ArrayList<>();
        }

        if (string.length() <= 10) {
            return new ArrayList<>();
        }

        List result = new ArrayList<>();

        char[] s = string.toCharArray();

        Map map = new HashMap<>();

        int code = 0;
        for (int i = 0; i < 10; ++i) {
            code = (code << 2) | mapping(s[i]);
            //    System.out.println(code);
        }

        map.put(code, 1);

        for (int i = 10; i < s.length; ++i) {

            code = ((code << 2) & (0xFFFFF)) | mapping(s[i]);

            // System.out.println(Integer.toBinaryString(code));

            Integer count = map.get(code);

            if (count == null) {
                map.put(code, 0);
                count = 0;
            }

            if (count == 1) {
                result.add(string.substring(i - 9, i + 1));
            }

            map.put(code, count + 1);
        }
        
        return result;
    }

    static int mapping(char s) {
        if (s == 'A') return 0;
        if (s == 'C') return 1;
        if (s == 'G') return 2;
        if (s == 'T') return 3;

        return -1;
    }

    public static void main(String[] args) {

        List result = findRepeatedDnaSequences(
                "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
        );

        for (String item : result) {
            System.out.println(item);
        }
    }
}

Comments

Post a Comment

Popular posts from this blog

Trie Data Structure and Finding Patterns in a Collection of Words

-
Image
 I faced a very hard problem recently about finding substrings based on a collection of patterns.  Example For  words = ["Apple", "Melon", "Orange", "Watermelon"]  and  parts = ["a", "mel", "lon", "el", "An"] , the output should be  findSubstrings(words, parts) = ["Apple", "Me[lon]", "Or[a]nge", "Water[mel]on"] . While  "Watermelon"  contains three substrings from the  parts  array,  "a" ,  "mel" , and  "lon" ,  "mel"  is the longest substring that appears first in the string. Note: Number of words and number of parts can be huge! A brute force method or careless usage of Java String methods would make it impossible to handle a large number of words and parts (patterns). Solution Approach Whenever we want to search patterns inside a string, we should think about the Trie data structure:  https://en.wikipedia....
Read more

Virtual Memory

-
The main memory can act as a “cache” for the secondary storage, usually implemented with magnetic disks. This technique is called virtual memory. There were two major motivations for virtual memory: to allow efficient and safe sharing of memory among multiple programs, and to remove the programming burdens of a small, limited amount of main memory. Lets consider a collection of programs running all at once on a computer. Of course, to allow multiple programs to share the same memory, we must be able to protect the programs from each other, ensuring that a program can only read and write the portions of main memory that have been assigned to it. Main memory need contain only the active portions of the many programs, just as a cache contains only the active portion of one program. Virtual memory allows us to efficiently share the processor as well as the main memory. We cannot know which programs will share the memory with other programs when we compile them. In fact, the programs s...
Read more

NOTES ON COMPUTER ARCHITECTURE: Some important concepts in computer architecture

-
A  virtual address  is a binary number in virtual memory that enables a process to use a location in primary storage (main memory) independently of other processes and to use more space than actually exists in primary storage by temporarily relegating some contents to a hard disk or internal flash drive. In a computer that incorporates memory management, the virtual address differs from the  physical address , which is the data location on an address bus that corresponds to a particular cell of primary storage or to a particular register in a memory-mapped I/O(input/output)  device. In a computer with both physical and virtual memory, a so-called  MMU (memory management unit)  coordinates and controls all of the memory resources, assigning portions called blocks to various running programs to optimize system performance. By translating between virtual add...
Read more